View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19455_high_9 (Length: 287)
Name: NF19455_high_9
Description: NF19455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19455_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 54 - 180
Target Start/End: Original strand, 21875409 - 21875535
Alignment:
| Q |
54 |
ttctaacatttactcttctattgagtgaaatacatgcaggtttcgtcacctttaaaatgggtccaatataaagagattggtttcatatgtatttactccg |
153 |
Q |
| |
|
|||||||||||| |||| |||||||| ||||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21875409 |
ttctaacatttattcttttattgagtaaaatacatgtaggtttcgtcacttttaaaatgagtccaatataaagagattggtttcatatgtatttactcca |
21875508 |
T |
 |
| Q |
154 |
atnnnnnnntgttaattttaaaataag |
180 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
21875509 |
ataaaaaaatgttaattttaaaataag |
21875535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University