View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19456_high_10 (Length: 299)
Name: NF19456_high_10
Description: NF19456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19456_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 9 - 281
Target Start/End: Original strand, 42945609 - 42945882
Alignment:
| Q |
9 |
attattcttcttactttttaaattgatctcaaacataccccacttacttcnnnnnnnn-gaagaaatatacctcttttattattaactgcagctgaacca |
107 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42945609 |
attattcttcttactttttaaattgctctcaaacataccccacttacttcttcttttttgaagaaatatacctcttttattattaactgcagctgaacca |
42945708 |
T |
 |
| Q |
108 |
aagacaattattaagaagagcaatttgagaaactataagagtaattttcaattcttaaaaatcctaaatatcctggtttacatataggtccatagcacag |
207 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42945709 |
aagacaattattaaaaagagcaatttgagaaactataagagtaattttcaattcttaaaaatcctaaatatcctggtttacatataggtccatagcacag |
42945808 |
T |
 |
| Q |
208 |
acacaagaagcccaacgacatacatgtggttactctttcacatctgtcttttatgcatggtttaatatcatatc |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42945809 |
acacaagaagcccaacgacatacatgtggttactctttcacatctgtcttttatgcatggtttaatatcatatc |
42945882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University