View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19456_high_12 (Length: 246)
Name: NF19456_high_12
Description: NF19456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19456_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 4 - 233
Target Start/End: Original strand, 4386757 - 4386982
Alignment:
| Q |
4 |
tttacacttggtagtaatctaaacttgaccaatttaagtttggtttaggccacataagtatgattatgtttggctggtgataaggatgaagaaaagctaa |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4386757 |
tttacacttggtagtaatctaaacttgaccaatttaagtttggttaaggccacataagtatgattatgtttgg----tgataaggatgaagaaaagctaa |
4386852 |
T |
 |
| Q |
104 |
gaatatatcacatggaaatggtgatatgccaagtggatcaaatttaaaacaaagatataaaaataattcaccaatatatatataattaagtttgctaaga |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4386853 |
gaatatatcacatggaaatggtgatatgccaagtggatcaaatttaaaacaaagatataaaaataattcaccaatatatatataattaactttgctaaga |
4386952 |
T |
 |
| Q |
204 |
catatagctgtgattcagtagagagcatca |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4386953 |
catatagctgtgattcagtagagagcatca |
4386982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University