View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19456_high_13 (Length: 231)
Name: NF19456_high_13
Description: NF19456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19456_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 7 - 172
Target Start/End: Complemental strand, 15323492 - 15323326
Alignment:
| Q |
7 |
caataatgggtctgcacttatatgtaagattttaggagttatgaaggaaacacacaaattaattaagcgaccaaatgtctaatttaactttaaattatgg |
106 |
Q |
| |
|
||||||||| |||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15323492 |
caataatggatctgcacttaaatgtacgattttaggagttatgaaggaaacacacaaattaattaagcgaccaaatgtctaatttaactttaaattatgg |
15323393 |
T |
 |
| Q |
107 |
tttagaattctcataatttgaaccagtaccatcctt-ggttgtttgcctttcaagtttgtccaatcc |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15323392 |
tttagaattctcataatttgaaccagtaccatccttaggttgtttgcctttcaagtttgtccaatcc |
15323326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University