View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19456_low_11 (Length: 291)
Name: NF19456_low_11
Description: NF19456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19456_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 15 - 278
Target Start/End: Complemental strand, 10339863 - 10339600
Alignment:
| Q |
15 |
agatttacctaaccctacgaagtgctaagtaagcaactaatctataaccaaacaacatcaaggccatgatgaacacatcaacccacatatgattcaatcc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10339863 |
agatttacctaaccctacgaagtgctaagtaagcaactaatctataaccaaacaacatcaaggccatgatgaacacatcaacccacatatgattcaatcc |
10339764 |
T |
 |
| Q |
115 |
cattgatttaattggaggaaagtccataaccttgcacaactctccctttgaacattcatagtaatcattttcattgtattgaacaccaagaagaagcttg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10339763 |
cattgatttaattggaggaaagtccataaccttgcacaactctccctttgaacattcatagtaatcattttcattgtattgaacaccaagaagaagcttg |
10339664 |
T |
 |
| Q |
215 |
taacagtagtagctatagcttaagtacttaagccaaactatgaaaggtggaatctgttgtatat |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10339663 |
taacagtagtagctatagcttaagtacttaagccaaactatgaaaggtggaatctgttgtatat |
10339600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University