View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19456_low_14 (Length: 228)
Name: NF19456_low_14
Description: NF19456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19456_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 17 - 212
Target Start/End: Original strand, 44298825 - 44299020
Alignment:
| Q |
17 |
aatattcgtagagaagaataaaactatgatcaaatatggaaacgagaaatattctgaagttgatgaacacaactttatctctgcatttaatccagcatga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44298825 |
aatattcgtagagaagaataaaactatgatcaaatatagaaacgagaaatattctgaagttgatgaacacaactttatctctgcatttaatccagcatga |
44298924 |
T |
 |
| Q |
117 |
tatgcatgagcttacatactcattgtataagttatgtacgnnnnnnntcaaatgataaagctcatttctttgcaagggtgacatcgttcttacttg |
212 |
Q |
| |
|
||| ||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44298925 |
tatccatgagcttacatactctttgtataagttatgtacgaagaaaatcaaatgataaagctcatttctttgcaagggtgacatcgttcttacttg |
44299020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University