View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19457_high_12 (Length: 250)
Name: NF19457_high_12
Description: NF19457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19457_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 10 - 207
Target Start/End: Complemental strand, 35501547 - 35501352
Alignment:
| Q |
10 |
aagaatataaatatgttatgggggtagtgtgcccccaaatgtcttatgtgtagatctgtgcatgttaatagactctctaatacactattttaataatttt |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35501547 |
aagaaaataaatatgttatgggggtagtg--cccccaaatgtcttatgtgtagatctgtgcatgttaatagactctctaatacactattttaataatttt |
35501450 |
T |
 |
| Q |
110 |
ttattgaagttattatgaatctcaccaatcctatattatacccacatgagttccgaatgatataattagttttattattgaaattatattatattttg |
207 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35501449 |
ttattaaagttattatgaatctcaccaatcctatattatacccacatgagttccgaatgatataattagttttattattgaaattatattatattttg |
35501352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University