View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19457_high_18 (Length: 207)
Name: NF19457_high_18
Description: NF19457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19457_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 4e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 17 - 194
Target Start/End: Complemental strand, 36534359 - 36534171
Alignment:
| Q |
17 |
atgatgtacttgtaatgatcctgagcttttgagtttctctcttgctgcttaagagagaaagaggttttgtttgtatctttgatcaagagggagcatagtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36534359 |
atgatgtacttgtaatgatcctgagcttttgagtttctctcttgctgcttaagagagaaagaggttttgtttgtatctttgatcaagagggagcatagtt |
36534260 |
T |
 |
| Q |
117 |
gttgaataggattaggacttcagattgaac-----------tggtaaattaattcagtcatggacctggttgagttttacataataatt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36534259 |
gttgaataggattaggacttcagattgaactggtggataactggtaaattaattcagtcatggacctggttgagttttacataataatt |
36534171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 96 - 151
Target Start/End: Complemental strand, 36539389 - 36539334
Alignment:
| Q |
96 |
tgatcaagagggagcatagttgttgaataggattaggacttcagattgaactggta |
151 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
36539389 |
tgatcaagagggatcatagttgttgaataagattgggacttcagattgaactggta |
36539334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University