View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19457_high_8 (Length: 306)
Name: NF19457_high_8
Description: NF19457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19457_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 80 - 295
Target Start/End: Complemental strand, 32481083 - 32480868
Alignment:
| Q |
80 |
ttgcataatagggagaaatgaataagaatataagataattagctcttcatgtcacccaattacttgtaattagcagaactttgatgtaacatgaaaattc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32481083 |
ttgcataatagggagaaatgaataagaatataagataattagctcttcatgtcacccaattacttgtaattagcagaactttgatgtaacatgaaaattc |
32480984 |
T |
 |
| Q |
180 |
ataatttcaacagttaaagttcttatatttgcaggaaatgaactcttcagttagaccaccataaacaatttactcagttggtcaatcagaatcagaaatg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32480983 |
ataatttcaacagttaaagttcttatatttgcaggaaatgaactcttcagtaagaccaccataaacaatttactcagttggtcaatcagaatcagaaatg |
32480884 |
T |
 |
| Q |
280 |
ttgatatcttcaaagt |
295 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
32480883 |
ttgatatcttcaaagt |
32480868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University