View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19457_low_10 (Length: 304)
Name: NF19457_low_10
Description: NF19457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19457_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 109 - 288
Target Start/End: Original strand, 48236762 - 48236941
Alignment:
| Q |
109 |
gttcagccttcctcttggcttcctctgctgcttccaatgcagctttggctttagccttctccctttctgctattgctagagctgcctcctgagataacct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48236762 |
gttcagccttcctcttggcttcctctgctgcttccaatgcagctttggctttagccttctccctttctgctattgctagagctgcctcctgagataacct |
48236861 |
T |
 |
| Q |
209 |
aacttccacaacctttcgtccctcttcctctttccatctacgaatttgttctgcctggtaacaagaaaaattattgtttt |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48236862 |
aacttccacaacctttcgtccctcttcctctttccatctacgaatttgttctgcctggtaacaagaaaaattattgtttt |
48236941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 48236654 - 48236700
Alignment:
| Q |
1 |
attttctatatcgattatcattttgagccaatgcattcaatacttta |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48236654 |
attttctatatcgattatcattttgagccaatgcattcaatacttta |
48236700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University