View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19457_low_20 (Length: 207)

Name: NF19457_low_20
Description: NF19457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19457_low_20
NF19457_low_20
[»] chr7 (2 HSPs)
chr7 (17-194)||(36534171-36534359)
chr7 (96-151)||(36539334-36539389)


Alignment Details
Target: chr7 (Bit Score: 151; Significance: 4e-80; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 17 - 194
Target Start/End: Complemental strand, 36534359 - 36534171
Alignment:
17 atgatgtacttgtaatgatcctgagcttttgagtttctctcttgctgcttaagagagaaagaggttttgtttgtatctttgatcaagagggagcatagtt 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36534359 atgatgtacttgtaatgatcctgagcttttgagtttctctcttgctgcttaagagagaaagaggttttgtttgtatctttgatcaagagggagcatagtt 36534260  T
117 gttgaataggattaggacttcagattgaac-----------tggtaaattaattcagtcatggacctggttgagttttacataataatt 194  Q
    ||||||||||||||||||||||||||||||           ||||||||||||||||||||||||||||||||||||||||||||||||    
36534259 gttgaataggattaggacttcagattgaactggtggataactggtaaattaattcagtcatggacctggttgagttttacataataatt 36534171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 96 - 151
Target Start/End: Complemental strand, 36539389 - 36539334
Alignment:
96 tgatcaagagggagcatagttgttgaataggattaggacttcagattgaactggta 151  Q
    ||||||||||||| ||||||||||||||| |||| |||||||||||||||||||||    
36539389 tgatcaagagggatcatagttgttgaataagattgggacttcagattgaactggta 36539334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University