View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19458_low_5 (Length: 213)

Name: NF19458_low_5
Description: NF19458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19458_low_5
NF19458_low_5
[»] chr8 (1 HSPs)
chr8 (17-195)||(45458613-45458791)


Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 45458791 - 45458613
Alignment:
17 atatgaagctgataacactggtaaacaggcagaaagtatatatatttactcaagggaacaataaaattaataaatcttaggtatgaagttagttgtaaga 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45458791 atatgaagctgataacactggtaaacaggcagaaagtatatatatttactcaagggaacaataaaattaataaatcttaggtatgaagttagttgtaaga 45458692  T
117 aaatgaaaatataaatgggagttgtgtataccacctgagagtgctggagtgaggactgcggccccaattgtcatacagg 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45458691 aaatgaaaatataaatgggagttgtgtataccacctgagagtgctggagtgaggactgcggccccaattgtcatacagg 45458613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University