View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19459_high_16 (Length: 347)
Name: NF19459_high_16
Description: NF19459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19459_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 103 - 332
Target Start/End: Complemental strand, 4051494 - 4051265
Alignment:
| Q |
103 |
aaaagatgcatatagatctctttaagtaattgcaaaacaaaaacaatcactttaattcaaaactttgatttgcattagtctaatttgttaaaattttaac |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4051494 |
aaaagatgcatatagatctctttaagtaattgcaaaacaaaaacaatcactttaatccaaaactttgatttgcattagtctaatttgttaaaattttaac |
4051395 |
T |
|
| Q |
203 |
aggtagacgtagacattgatattgatacctctccatcattccctattacagaagaaatgagaatgaaagcacagtatttaaggttttgtgatccctctct |
302 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4051394 |
aggtagatgtagacattgatattgatacctctccatcattccctattacagaagaaatgagaatgaaagcacagtatttaaggttttgtgatccctctct |
4051295 |
T |
|
| Q |
303 |
ctactatcatagagattgttacatattttt |
332 |
Q |
| |
|
||||||||| |||||||||||||||||||| |
|
|
| T |
4051294 |
ctactatcagagagattgttacatattttt |
4051265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 12 - 53
Target Start/End: Complemental strand, 4051585 - 4051544
Alignment:
| Q |
12 |
cacagatattgatgagattccattggtactttcacaccctca |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4051585 |
cacagatattgatgagattccattggtactttcacaccctca |
4051544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University