View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19459_high_7 (Length: 447)
Name: NF19459_high_7
Description: NF19459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19459_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 147 - 437
Target Start/End: Complemental strand, 48065736 - 48065446
Alignment:
| Q |
147 |
ctaaactcgaccttagcatgttgttttcttggggaagaagattccaacagactctacgacataacataaggccgttgtgtagccaatcacaacgctccac |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48065736 |
ctaaactcgaccttagcatgttgttttcttggggaagaagattccaacagactctacgatataacataaggccgttgtgtagccaatcacaacgctccac |
48065637 |
T |
 |
| Q |
247 |
gtcttcgtcttcttctccgttgagctcttttgatgggtccggaaatggtggtgatgaaagggttagagattttgagtattttcttaggacaataacttct |
346 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48065636 |
gtcatcgtcttcttctccgttgagctcttttgatgggtccggaaatggtggtgatgaaagggttagagattttgagtattttcttaggacaataacttct |
48065537 |
T |
 |
| Q |
347 |
ggggctgtggttgttggtaccaccttaggcttttggtattggtcatctttatcttctccgagtgctaataactctttgcattctttctctg |
437 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48065536 |
ggggctgtggttgttggtaccaccttaggcttttggtattggtcatctttatcttctccgagtgctaataactctttgcattctttctctg |
48065446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 48065861 - 48065797
Alignment:
| Q |
18 |
cttccctctcaaacgttttcttctcttaacaacctcaaatttctaccttcaacctaaacaagtaa |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48065861 |
cttccctctcaaacgttttcttctcttaacaacctcaaatttctaccttcaacctaaacaagtaa |
48065797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University