View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19459_low_17 (Length: 341)
Name: NF19459_low_17
Description: NF19459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19459_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 25 - 140
Target Start/End: Original strand, 47153811 - 47153926
Alignment:
| Q |
25 |
ggacggatatcaatgaagcattagttgacctcgttatggtgagttcactttgcgttcttacttgcaatcatagtaaaaagtaaacacataatcagctatc |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47153811 |
ggacggatatcaatgaagcattagttgacctcgttatggtgagttcactttgcgttcttacttacaatcatagtaaaaagtaaacacataatcagctatc |
47153910 |
T |
 |
| Q |
125 |
cagctgcagtatcatc |
140 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
47153911 |
cagctgcagtatcatc |
47153926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 230 - 325
Target Start/End: Original strand, 47154012 - 47154107
Alignment:
| Q |
230 |
accaaaagccaaagtggaccattgtcttcaccagcattttgttaattatgcaaccaaattcaagtctataaaagtaatgtaccgaaggtttatttc |
325 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47154012 |
accaatagccaaagtggaccattgtcttcaccagcattttgttaattatgcaaccaaattcaagtctataaaagtaatgtacccaaggtttatttc |
47154107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University