View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1945_high_4 (Length: 367)
Name: NF1945_high_4
Description: NF1945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1945_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 30 - 353
Target Start/End: Original strand, 40648409 - 40648726
Alignment:
| Q |
30 |
aatcagccattttctgaaccttttgcagagcaccgaacgagagaaagaaggatttgtgtgtgaccacaagtagtttgtggccttttggaaaaggatctag |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40648409 |
aatcagccattttctgaaccttttgcagagcaccgaacgagagaaagaaggatttttgtgtgaccacaagtagtttgtggccttttggagaaggatctag |
40648508 |
T |
|
| Q |
130 |
aactgtttaggaggagtaggagagacgtttatgtttgatttgatttgagggtttgtgcacacgaaataagataattgtatgattgccacgtgtcaggtct |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40648509 |
aactgtttaggaggagtaggagagacgtttatgtttgatttgatttgagggtttgtgcacacgaaataagataattgtatgattgccacgtgtccggtct |
40648608 |
T |
|
| Q |
230 |
gatttcgatttaacggctcagatgatgactctctcgcgatacggaaacggtagtattttattttaaattttttacgtatacttatacttcattcagaaca |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40648609 |
gatttcgatttaacggctcagatgatgactctctcgcgatacggaaacggtagtattttattttaaattttttacg------tatacttcattcagaaca |
40648702 |
T |
|
| Q |
330 |
ggtccaattgtcctaaacatggtc |
353 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40648703 |
ggtccaattgtcctaaacatggtc |
40648726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University