View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1945_low_11 (Length: 261)
Name: NF1945_low_11
Description: NF1945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1945_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 6 - 245
Target Start/End: Original strand, 33408320 - 33408556
Alignment:
| Q |
6 |
agatgctattcgtggcaatttcatgcagaacattctttcagtagttctgccnnnnnnngttgatctaatacctcaagaggaacnnnnnnnnnnnnnnnnn |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
33408320 |
agatgctattcgtggcaatttcatgcagaacattctttcagtagtactgccaaaaaaagttgatctaatacctcaagaggaacaagaagaagaagaa--- |
33408416 |
T |
|
| Q |
106 |
aaaatgccagaacttgaagatttggataaatatcaagagaaaaatacatataagagtttgggatttggaggaagagatagagaagaagagattgaaacac |
205 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33408417 |
aaaattccagaacttgaagatttggataaatatcaagagaaaaatacatataagagtttgggatttggaggaagagatagagaagaagagattggaacac |
33408516 |
T |
|
| Q |
206 |
tatcagaatatacttacagaaaagacaacaagtttggtga |
245 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33408517 |
tatcagaatatacttacagaacagacaacaagtttggtga |
33408556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University