View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1945_low_2 (Length: 253)
Name: NF1945_low_2
Description: NF1945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1945_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 52 - 230
Target Start/End: Complemental strand, 43883002 - 43882824
Alignment:
| Q |
52 |
ataatatctgttcctttagaggagttaaattcatggttagtataatattcatatgctctactaaaagcaaagtgaagaatagcatgacctctgagcaagg |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43883002 |
ataatatctgttcctttagaggagttaaattcatggttagtataatattcatatgctctactaaaagcaaagtgaagaatagcatgacctctgagcaagg |
43882903 |
T |
 |
| Q |
152 |
atgacagatacagcataaatcgagagaatttcattttaacatgcatatacctgatgatttctttgaggggtcctttgct |
230 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43882902 |
ataacagatacagcataaatcgagagaatttcattttaacttgcatatacctgatgatttctttgaggggtcctttgct |
43882824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 62 - 99
Target Start/End: Complemental strand, 43883033 - 43882996
Alignment:
| Q |
62 |
ttcctttagaggagttaaattcatggttagtataatat |
99 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43883033 |
ttcctttagaggagttaaattcattgttagtataatat |
43882996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University