View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1945_low_7 (Length: 324)
Name: NF1945_low_7
Description: NF1945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1945_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 98 - 295
Target Start/End: Original strand, 35471897 - 35472093
Alignment:
| Q |
98 |
agtgtaacttttttaccatccatagtaaaatatcaaagtgcaaatccaagttaaaataaaacagagctaagaattgtgtcagaatatatataccaaaata |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35471897 |
agtgtaacttttttaccatccat-gtaaaatatcaaactgcaaatccaagttaaaataaaacagagctaagaattgtgtcagaatatatataccaaaata |
35471995 |
T |
|
| Q |
198 |
tccaacatattaatttcttcttacatatccttcttcccttttagattctctctcaataccccccgtgtgctccctcacttctccccctccattaattc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35471996 |
tccaacatattaatttcttcttacatatccttcttcccttttagattctctctcaataccccccgtgtgctccctcacttctccccctccattaattc |
35472093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University