View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19460_low_4 (Length: 241)
Name: NF19460_low_4
Description: NF19460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19460_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 20 - 226
Target Start/End: Original strand, 43817247 - 43817453
Alignment:
| Q |
20 |
ccccatccacagaaaatttatgttccccggcacccttggtcactttcaaaatcaccgtctcaacatgtttcgcatccaccgtctctcccttttccgtgga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43817247 |
ccccatccacagaaaatttatgttccccggcacccttggtcactttcaaaatcaccgtctcaacatgtttcgcatccaccgtctctcccttttccgtgga |
43817346 |
T |
|
| Q |
120 |
cccacatattttcgtatcacgcgataaatctacactctcatcaaagaaagtgtagttatcataacgaagaaaacaaccgtcgaggtaaattctacctgaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43817347 |
cccacatattttcgtatcacgcgataaatctacactctcatcaaagaaagtgtagttatcataacgaagaaaacaaccgtcgaggtaaattctacctgaa |
43817446 |
T |
|
| Q |
220 |
acctttg |
226 |
Q |
| |
|
||||||| |
|
|
| T |
43817447 |
acctttg |
43817453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University