View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19460_low_6 (Length: 225)
Name: NF19460_low_6
Description: NF19460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19460_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 1981758 - 1981718
Alignment:
| Q |
8 |
agaaatcttccattgtcttttgctactaactttcttaattt |
48 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1981758 |
agaaatcatccattgtcttttgctactaactttcttaattt |
1981718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University