View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19461_high_5 (Length: 229)
Name: NF19461_high_5
Description: NF19461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19461_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 19 - 209
Target Start/End: Original strand, 6127594 - 6127784
Alignment:
| Q |
19 |
attatagcgatgacgagtaatggatgagaaggagagaactagaagaaagac-----gggaacaaattgagtggtttaaaaataaaagtaccaccttttga |
113 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6127594 |
attatagcgatgaggagtaatggatgagaaggagagaa------gaaagacctagggggaacaaattgagtggtttaaaaataaaagtaccaccttttga |
6127687 |
T |
|
| Q |
114 |
cggaagaaataatttagagacttattcagaatgggaaacaaaaattgaacgaatttttgttgtaacacct-tattaacgttaaaaagatgcaggttg |
209 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6127688 |
cggaagaaataattcagagacttatttagaatgggaaacaaaaatggaacgaatttttgttgtaacacctgtattaacgttaaaaagatgcaggttg |
6127784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University