View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19461_low_5 (Length: 229)

Name: NF19461_low_5
Description: NF19461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19461_low_5
NF19461_low_5
[»] chr2 (1 HSPs)
chr2 (19-209)||(6127594-6127784)


Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 19 - 209
Target Start/End: Original strand, 6127594 - 6127784
Alignment:
19 attatagcgatgacgagtaatggatgagaaggagagaactagaagaaagac-----gggaacaaattgagtggtttaaaaataaaagtaccaccttttga 113  Q
    ||||||||||||| ||||||||||||||||||||||||      |||||||     ||||||||||||||||||||||||||||||||||||||||||||    
6127594 attatagcgatgaggagtaatggatgagaaggagagaa------gaaagacctagggggaacaaattgagtggtttaaaaataaaagtaccaccttttga 6127687  T
114 cggaagaaataatttagagacttattcagaatgggaaacaaaaattgaacgaatttttgttgtaacacct-tattaacgttaaaaagatgcaggttg 209  Q
    |||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||    
6127688 cggaagaaataattcagagacttatttagaatgggaaacaaaaatggaacgaatttttgttgtaacacctgtattaacgttaaaaagatgcaggttg 6127784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University