View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19462_high_12 (Length: 251)
Name: NF19462_high_12
Description: NF19462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19462_high_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 236; Significance: 1e-130; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 33909568 - 33909807
Alignment:
| Q |
1 |
atagaagctttttgaacaattctggtttatgtgctgatacaccaaaattgaaccttaccttatgcaattctaattccaacactcaaagtgaaagcaaaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33909568 |
atagaagctttttgaacaattctggtttatgtgctgatacaccaaaattgaaccttaccttgtgcaattctaattccaacactcaaagtgaaagcaaaga |
33909667 |
T |
|
| Q |
101 |
ttcatctttatctcctgctttgattggaattttggtggtagtttcgatcttagtggcttcattgatatcgtttgtgattatcaaactttacagtaaaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33909668 |
ttcatctttatctcctgctttgattggaattttggtggtagtttcgatcttagtggcttcattgatatcgtttgtgattatcaaactttacagtaaaaga |
33909767 |
T |
|
| Q |
201 |
aaacaaggatcggataactcatcatggaaactcacttcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33909768 |
aaacaaggatcggataactcatcatggaaactcacttcat |
33909807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 33885343 - 33885397
Alignment:
| Q |
1 |
atagaagctttttgaacaattctggtttatgtgctgatacaccaaaattgaacct |
55 |
Q |
| |
|
|||||||||||||||||||||| | |||||||| |||||||| | ||||||||| |
|
|
| T |
33885343 |
atagaagctttttgaacaattcagatttatgtgttgatacacaagcattgaacct |
33885397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 33895929 - 33895875
Alignment:
| Q |
1 |
atagaagctttttgaacaattctggtttatgtgctgatacaccaaaattgaacct |
55 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| || ||||| | ||||||||| |
|
|
| T |
33895929 |
atagaagctttttgaacaattctggtgtatgtgttggtacacaagcattgaacct |
33895875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University