View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19462_low_9 (Length: 295)
Name: NF19462_low_9
Description: NF19462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19462_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 25 - 159
Target Start/End: Complemental strand, 15677302 - 15677168
Alignment:
| Q |
25 |
gttagggcattgtgaaattgagagacaatcaagcaatgacgtttggcgggaatttagtgagcccatttggagcccaacattgcttattacaattttgctt |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15677302 |
gttagggcattgtgaaattgagagacaatcaagcaatgacgtttggcgggaatttagtgagcccatttggatcccaacattgcttattacaattttgctt |
15677203 |
T |
|
| Q |
125 |
ttttggcccccaaactggtttgattccaacatttt |
159 |
Q |
| |
|
|||||| ||||||| | |||||||||||||||||| |
|
|
| T |
15677202 |
ttttggaccccaaagtagtttgattccaacatttt |
15677168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 162 - 274
Target Start/End: Complemental strand, 15677078 - 15676964
Alignment:
| Q |
162 |
tttagatttttcgaattgtaaccccgatcgtacaaaattaattgggagttatgacccgattagaggttgagtaatcttat--gagttatgaagcgatcac |
259 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||| |||||||||||||||||||||| |||||||||||| |||| |||||||||| ||||||| |
|
|
| T |
15677078 |
tttagatttttcgaattgtatccctgatcgtacaaaatttattgggagttatgacccgattaaaggttgagtaattttatgagagttatgaaacgatcac |
15676979 |
T |
|
| Q |
260 |
ataagagtaccttaa |
274 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
15676978 |
ataagagtactttaa |
15676964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University