View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19463_high_19 (Length: 367)
Name: NF19463_high_19
Description: NF19463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19463_high_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 154 - 351
Target Start/End: Original strand, 40384930 - 40385127
Alignment:
| Q |
154 |
gttgagaagtttgatgaattgaagggatacttgtgcacgtgtgatgtctttctttctaaaatgtctcactctgatcccatgtgtgttgtttatttacttc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40384930 |
gttgagaagtttgatgaattgaagggatacttgtgcacgtgtgatgtctttctttctaaaatgtctcactctgatcccatgtgtgttgtttatttagttc |
40385029 |
T |
|
| Q |
254 |
attaaaaatcgtaaaatatgggatagagatgccaatttgatacacaaatatatctatgtattatagcatagttagttttatgttttttcatatgtaat |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40385030 |
attaaaaatcgtaaaatatgggatagagatgccaatttgatacacaaatatatctatgtattatagcatagttagttttatgttttttcatatgtaat |
40385127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 12 - 86
Target Start/End: Original strand, 40384788 - 40384862
Alignment:
| Q |
12 |
atgaatgagaatcagctgcaagtagtagtgatccctcttcaaaatgttgttgatatcgaaactacaatggagaat |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40384788 |
atgaatgagaatcagctgcaagtagtagtgatccctcttcaaaatgttgttgatatcgaaactacaatggagaat |
40384862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University