View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19463_high_24 (Length: 303)

Name: NF19463_high_24
Description: NF19463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19463_high_24
NF19463_high_24
[»] chr7 (1 HSPs)
chr7 (17-254)||(32238185-32238430)
[»] chr1 (1 HSPs)
chr1 (198-254)||(23970514-23970571)
[»] chr2 (1 HSPs)
chr2 (195-252)||(24579415-24579474)


Alignment Details
Target: chr7 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 17 - 254
Target Start/End: Original strand, 32238185 - 32238430
Alignment:
17 atataacttaaataaacgctttattttatttttacaaataattaaaggaatacca---agtaaattctaagtgcaaaacgtgtccaaaataatacacaaa 113  Q
    |||||||||||||||||||||||||||||||||||||||||  || |||||||||   ||||||||||||||||||||||||||||||||||||||||||    
32238185 atataacttaaataaacgctttattttatttttacaaataa--aatggaataccattaagtaaattctaagtgcaaaacgtgtccaaaataatacacaaa 32238282  T
114 atgtccaaatcgtacgatttcaatgggcaaaattgtgacttactcg-----caaaactcccatcattatatttgagccacaatcaatagcagggg-aggc 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||     ||||||||||||||||||||||||||||||| ||| ||||||||  | |    
32238283 atgtccaaatcgtacgatttcaatgggcaaaattgtgacttactcgataaccaaaactcccatcattatatttgagccacaaccaagagcaggggttgac 32238382  T
208 cctgagcacgggctc-ggggcgacatcccaggccaccataattttagg 254  Q
    ||||||||||||||| ||||||| | |||||| |||||||||||||||    
32238383 cctgagcacgggctcgggggcgatagcccagggcaccataattttagg 32238430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 198 - 254
Target Start/End: Original strand, 23970514 - 23970571
Alignment:
198 caggggaggccctgagcacgggctc-ggggcgacatcccaggccaccataattttagg 254  Q
    |||||| |||||||||||||||||| ||||||||| |||||| ||||| |||||||||    
23970514 caggggcggccctgagcacgggctcgggggcgacagcccagggcaccacaattttagg 23970571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 195 - 252
Target Start/End: Complemental strand, 24579474 - 24579415
Alignment:
195 tagcaggggaggccctgagcacgggctc--ggggcgacatcccaggccaccataatttta 252  Q
    ||||||||| ||||||||||||||||    ||||||||| |||||| |||||||||||||    
24579474 tagcaggggtggccctgagcacgggccgagggggcgacagcccagggcaccataatttta 24579415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University