View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19463_high_29 (Length: 260)

Name: NF19463_high_29
Description: NF19463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19463_high_29
NF19463_high_29
[»] chr6 (1 HSPs)
chr6 (76-251)||(491688-491860)


Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 76 - 251
Target Start/End: Original strand, 491688 - 491860
Alignment:
76 gagggataccgatagatttaatgttgaaagaagctctccaagattgagtgacgtgattttaagtggaaaacaactagagatttctccaagaagctcgtct 175  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||    
491688 gagggataccgatagatttaatgttgcaagaagctctccaagattgagtgacgtgattttaagtggaaaac---tagagatttctccaagaagctcgtct 491784  T
176 aggtcaccgcaaaagtaagagaggtcgagggaggaattccagataatgagtgagaaacgggaaaggttgatgatgt 251  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
491785 aggtcaccgcgaaagtaagagaggtcgagggaggaattccagataatgagtgagaaacgggaacggttgatgatgt 491860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University