View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19463_high_32 (Length: 243)
Name: NF19463_high_32
Description: NF19463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19463_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 1509333 - 1509117
Alignment:
| Q |
18 |
agaattgcacgttaatcctgacattgnnnnnnn-gattccttatttgaaagaagagaaaatgaaaatgaagagaattagggattatatatagttggttat |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1509333 |
agaattgcacgttaatcctgacattgttttttttgattccttagttgaaagaagagaaaatgaaaatgaagagaattagggattatatatagttggttat |
1509234 |
T |
 |
| Q |
117 |
aggcaaaagaaattaattattatttttgtttg-ttgtcggcgaaacggtgaagattgaacgaaccaaggttttgcttgcaatcagcgcttgcgtaatgtc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1509233 |
aggcaaaagaaattaattattatttttgtttgtttgtcggcgaaacggtgaagattgaacgaaccaaggttttgcttgcaatcagcgcttgcgtaatgac |
1509134 |
T |
 |
| Q |
216 |
gttgtggaccggttcat |
232 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1509133 |
gttgtggaccggttcat |
1509117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University