View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19463_high_35 (Length: 237)
Name: NF19463_high_35
Description: NF19463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19463_high_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 45 - 220
Target Start/End: Original strand, 20079793 - 20079966
Alignment:
| Q |
45 |
tcttttaagtaagaaaacattatttctacaaatcagcctttgcaacttttacatatggatttatttgctccatctagaactatgagttttggtggcaatt |
144 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20079793 |
tcttttaaataagaaaacattatttctaaaaatcagcctttgcaacttttacatatggatttatttgctccatctagaactatgagttttggtggcaatt |
20079892 |
T |
 |
| Q |
145 |
attatgtacttgttattgtggataactctattcactctatacatggactttgtttatttctcataaaaacgacgat |
220 |
Q |
| |
|
| ||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20079893 |
actatgtacttgttattgtggatga--ctattcactctatacatggactttgtttatttctcataaaaacgacgat |
20079966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 58
Target Start/End: Original strand, 8925133 - 8925173
Alignment:
| Q |
18 |
tgtcaaaaaggaaaacaagtaaaggcctcttttaagtaaga |
58 |
Q |
| |
|
||||||||||||||||||||||| || |||||||| ||||| |
|
|
| T |
8925133 |
tgtcaaaaaggaaaacaagtaaatgcttcttttaaataaga |
8925173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University