View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19463_high_38 (Length: 205)
Name: NF19463_high_38
Description: NF19463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19463_high_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 50 - 187
Target Start/End: Original strand, 11178564 - 11178701
Alignment:
| Q |
50 |
aacaagaagaaaagaagtattattgtaaaaattgattgagtttggtatagtgaaataagagtattgaaaaataactttaccaaactgaaagaatcttgtt |
149 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11178564 |
aacaagaagaaaagaagtgttattgtaaaaattgattgagtttggtatagtgaaacaagagtattgaaaaataactttaccaaactgaaagaatcttgtt |
11178663 |
T |
|
| Q |
150 |
cttggttcttcaagtctgtctcctcttaacgtctcttc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11178664 |
cttggttcttcaagtctgtctcctcttaacgtctcttc |
11178701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University