View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19463_low_19 (Length: 378)
Name: NF19463_low_19
Description: NF19463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19463_low_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 20 - 363
Target Start/End: Original strand, 10506765 - 10507107
Alignment:
| Q |
20 |
tttccaacacataaacctgattttacatatcttggtcctactttgaggagggaacatggacatgaatatccacattcacacaatttcacgagaccacatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10506765 |
tttccaacacataaacctgattttacatatcttggtcctactttgaggagggaacatgcacatgaatatccacattcacacaatttcatgagaccacatg |
10506864 |
T |
|
| Q |
120 |
gccagttttaaccaacacttcactttcagacctcataaattaaagtttctagcaaagatacatgcatggttgaatttgtaatctcaaacttttcatagct |
219 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| ||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10506865 |
gccagttttaaccaacatttcactttcagacctcataaa-----gttgctagcaaagatacatgcatggttgtatttgtaatctcaaacttttcatagct |
10506959 |
T |
|
| Q |
220 |
tagaaaaatctgttttagtcaatatttgtcgtgtatttttaaacgtgttatcctggtcttctagaaagcatttacaattgttttgtattttgtgttttag |
319 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10506960 |
tagaaaaatctgttttagtcaatatttgttgtgtatttttaaacgtgttatcttggtcttctagaaagcatttacaattgttttgtattttgtgttttag |
10507059 |
T |
|
| Q |
320 |
ggattgc----tatgggaactcaaatgtttcatttcaagttttaagtt |
363 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10507060 |
ggattgctatatatgggaactcaaatgtttcatttcaagttttaagtt |
10507107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University