View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19463_low_25 (Length: 303)
Name: NF19463_low_25
Description: NF19463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19463_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 17 - 254
Target Start/End: Original strand, 32238185 - 32238430
Alignment:
| Q |
17 |
atataacttaaataaacgctttattttatttttacaaataattaaaggaatacca---agtaaattctaagtgcaaaacgtgtccaaaataatacacaaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32238185 |
atataacttaaataaacgctttattttatttttacaaataa--aatggaataccattaagtaaattctaagtgcaaaacgtgtccaaaataatacacaaa |
32238282 |
T |
 |
| Q |
114 |
atgtccaaatcgtacgatttcaatgggcaaaattgtgacttactcg-----caaaactcccatcattatatttgagccacaatcaatagcagggg-aggc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |||||||| | | |
|
|
| T |
32238283 |
atgtccaaatcgtacgatttcaatgggcaaaattgtgacttactcgataaccaaaactcccatcattatatttgagccacaaccaagagcaggggttgac |
32238382 |
T |
 |
| Q |
208 |
cctgagcacgggctc-ggggcgacatcccaggccaccataattttagg |
254 |
Q |
| |
|
||||||||||||||| ||||||| | |||||| ||||||||||||||| |
|
|
| T |
32238383 |
cctgagcacgggctcgggggcgatagcccagggcaccataattttagg |
32238430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 198 - 254
Target Start/End: Original strand, 23970514 - 23970571
Alignment:
| Q |
198 |
caggggaggccctgagcacgggctc-ggggcgacatcccaggccaccataattttagg |
254 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||| |||||| ||||| ||||||||| |
|
|
| T |
23970514 |
caggggcggccctgagcacgggctcgggggcgacagcccagggcaccacaattttagg |
23970571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 195 - 252
Target Start/End: Complemental strand, 24579474 - 24579415
Alignment:
| Q |
195 |
tagcaggggaggccctgagcacgggctc--ggggcgacatcccaggccaccataatttta |
252 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||| |||||| ||||||||||||| |
|
|
| T |
24579474 |
tagcaggggtggccctgagcacgggccgagggggcgacagcccagggcaccataatttta |
24579415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University