View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19463_low_30 (Length: 260)
Name: NF19463_low_30
Description: NF19463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19463_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 76 - 251
Target Start/End: Original strand, 491688 - 491860
Alignment:
| Q |
76 |
gagggataccgatagatttaatgttgaaagaagctctccaagattgagtgacgtgattttaagtggaaaacaactagagatttctccaagaagctcgtct |
175 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
491688 |
gagggataccgatagatttaatgttgcaagaagctctccaagattgagtgacgtgattttaagtggaaaac---tagagatttctccaagaagctcgtct |
491784 |
T |
|
| Q |
176 |
aggtcaccgcaaaagtaagagaggtcgagggaggaattccagataatgagtgagaaacgggaaaggttgatgatgt |
251 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
491785 |
aggtcaccgcgaaagtaagagaggtcgagggaggaattccagataatgagtgagaaacgggaacggttgatgatgt |
491860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University