View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19463_low_31 (Length: 259)
Name: NF19463_low_31
Description: NF19463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19463_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 13 - 241
Target Start/End: Complemental strand, 8333052 - 8332824
Alignment:
| Q |
13 |
aatatcaactttactttctttgtgcctctaatcaagtcgaaaccttcaacctctaggaccctagaatttctcatgtcgtcctttcacttcttcgaattga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8333052 |
aatatcaactttactttctttgtgcctctaatcaagtcgaaaccttcaacctctaggaccctagaatttctcatgtcgtcctttcacttcttcgaattga |
8332953 |
T |
 |
| Q |
113 |
aagattagataaatgggaattttcctaccaagtgcaagaaacaaacccaattggatgaacccacaccaa-tttgaagaaaactaatgagagcatagcaaa |
211 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8332952 |
aagattagataaat-ggaattttcctaccaaatgcaagaaacaaacccaattggatgaacccacaccaattttgaagaaaactaatgagagcatagcaaa |
8332854 |
T |
 |
| Q |
212 |
catgattattaatagcaagggttgatggtc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
8332853 |
catgattattaatagcaagggttgatggtc |
8332824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University