View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19464_high_4 (Length: 316)
Name: NF19464_high_4
Description: NF19464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19464_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 38604394 - 38604522
Alignment:
| Q |
1 |
acaataacgccgtttccatccacagaacctcttgtccatttgcgtgccacacttgccgccgatctactttctttccaaccccacctctctgacgtacacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38604394 |
acaataacgccgtttccatccacagaacctcttgtccatttgcgtgccacacttgccgccgatctactttctttccaaccccacctctctgacgtacacc |
38604493 |
T |
|
| Q |
101 |
tctctcagttcaacacttcacgttttcat |
129 |
Q |
| |
|
||||||||||||||||||| ||||||||| |
|
|
| T |
38604494 |
tctctcagttcaacacttcccgttttcat |
38604522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 196 - 302
Target Start/End: Original strand, 38604591 - 38604697
Alignment:
| Q |
196 |
ctgttacatagttgttgatttgtaaaattggaagagttcatgattagttgcttgtactgttgtacttgattatgtggattgctcttaattggaaccatgg |
295 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38604591 |
ctgttacataattgttgatttgtaaaattggaagagttcatgattagttgcttgtactgttgtacttgattatgtggattgctcttaattggaaccatgg |
38604690 |
T |
|
| Q |
296 |
ttgtgtc |
302 |
Q |
| |
|
||||||| |
|
|
| T |
38604691 |
ttgtgtc |
38604697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University