View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19465_high_5 (Length: 268)
Name: NF19465_high_5
Description: NF19465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19465_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 30 - 252
Target Start/End: Original strand, 11040018 - 11040252
Alignment:
| Q |
30 |
ttgctggggaatggacaacatatcagtttttggtttgataactggtgtggtgattcattgattaaatccctaaatgtcacaactgatatgattgaggact |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11040018 |
ttgctggggaatggacaacatatcagtttttggtttgataactggtgtggtgattcattgattaaatccctaaatgtcacaactgatatgattgaggact |
11040117 |
T |
 |
| Q |
130 |
acacaatttctgag------------tttaactggaagcttgaatctctggagcaaagattttctgatatcagaagacttgtgtcacaagttactatctc |
217 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
11040118 |
acacagtttctgagtatattgaaaattttaactggaagcttgaatctctggagcaaagatttcctgatatcagaagacttgtgtcacaagttactatccc |
11040217 |
T |
 |
| Q |
218 |
attgcttgacaaacccaacagtttaatgtggaagc |
252 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
11040218 |
attgcttgacaaacccgacagtttaatgtggaagc |
11040252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University