View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19465_high_5 (Length: 268)

Name: NF19465_high_5
Description: NF19465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19465_high_5
NF19465_high_5
[»] chr2 (1 HSPs)
chr2 (30-252)||(11040018-11040252)


Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 30 - 252
Target Start/End: Original strand, 11040018 - 11040252
Alignment:
30 ttgctggggaatggacaacatatcagtttttggtttgataactggtgtggtgattcattgattaaatccctaaatgtcacaactgatatgattgaggact 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11040018 ttgctggggaatggacaacatatcagtttttggtttgataactggtgtggtgattcattgattaaatccctaaatgtcacaactgatatgattgaggact 11040117  T
130 acacaatttctgag------------tttaactggaagcttgaatctctggagcaaagattttctgatatcagaagacttgtgtcacaagttactatctc 217  Q
    ||||| ||||||||            |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |    
11040118 acacagtttctgagtatattgaaaattttaactggaagcttgaatctctggagcaaagatttcctgatatcagaagacttgtgtcacaagttactatccc 11040217  T
218 attgcttgacaaacccaacagtttaatgtggaagc 252  Q
    |||||||||||||||| ||||||||||||||||||    
11040218 attgcttgacaaacccgacagtttaatgtggaagc 11040252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University