View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19465_high_8 (Length: 226)
Name: NF19465_high_8
Description: NF19465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19465_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 212
Target Start/End: Original strand, 9279983 - 9280175
Alignment:
| Q |
18 |
ctcttgatgtatcattaatgtgattttgttgtactttgaagattattcttcaacctgtcagtatatgtaaacttgaatgcataatgaaaaataaattgat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9279983 |
ctcttgatgtatcattaatgtgattttgttgtaatttgaagattattcttcaacctgtcagtatatgtaaactcgaatgcataatgaaaaataaattgat |
9280082 |
T |
 |
| Q |
118 |
atacaatcacttgaagttggattttattctctctgtctaataattgctgacttgcaatcatcttcacttatcttttaatttgtatacctcctttg |
212 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9280083 |
atacaatcacttgaagttggatttta--ctctctgtctaataattgctgacttgcaatcatcttcacttatcttttaatttgtatacctcttttg |
9280175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University