View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19466_low_11 (Length: 276)
Name: NF19466_low_11
Description: NF19466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19466_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 16 - 260
Target Start/End: Complemental strand, 46110710 - 46110466
Alignment:
| Q |
16 |
atatacatgatcgacacaaaataggaaaatgatattatctactttgaagtgtctcccctgccaaactcaagggaagtaataggcgaagtttcaaatacag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46110710 |
atatacatgatcgacacaaaataggaaaatgatattatctactttgaagtctctcccctgccaaactcaagggaagtaataggcgaagtttcagatacag |
46110611 |
T |
 |
| Q |
116 |
cacattgggaatcagaatttggcttggacttatccttgaagtttacaccaggtggagaggttgatgttccagcaaaattttcatcatttttggagtcaga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46110610 |
cacattgggaatcagaatttggcttggacttatccttgaagtttacaccaggtggagaggttgatgttccagcaaaattttcatcatttttggagtcaga |
46110511 |
T |
 |
| Q |
216 |
tgctacaggttcctcaactgtccggatgggtgtggctaacaggtc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46110510 |
tgctacaggttcctcaactgtccggatgggtgtggctaacgggtc |
46110466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 120 - 233
Target Start/End: Complemental strand, 46101147 - 46101034
Alignment:
| Q |
120 |
ttgggaatcagaatttggcttggacttatccttgaagtttacaccaggtggagaggttgatgttccagcaaaattttcatcatttttggagtcagatgct |
219 |
Q |
| |
|
||||| |||||| |||| |||||||||||||||| ||||||||| || |||||| ||||||||||| |||||||| |||||| |||||||||| ||||| |
|
|
| T |
46101147 |
ttgggcatcagactttgacttggacttatccttggagtttacactagatggagaagttgatgttcctgcaaaattctcatcacttttggagtctgatgcc |
46101048 |
T |
 |
| Q |
220 |
acaggttcctcaac |
233 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
46101047 |
acaggttcatcaac |
46101034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University