View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19467_high_12 (Length: 458)

Name: NF19467_high_12
Description: NF19467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19467_high_12
NF19467_high_12
[»] chr2 (2 HSPs)
chr2 (39-176)||(26834777-26834914)
chr2 (236-313)||(26834983-26835060)


Alignment Details
Target: chr2 (Bit Score: 122; Significance: 2e-62; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 39 - 176
Target Start/End: Original strand, 26834777 - 26834914
Alignment:
39 gtctcaagtggcattgcaaggagagaaggaacaatggtgtgttcatgaaagaatttaggttacctgagaatgcaaaagttgatgatgtcaaggcttcaat 138  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||    
26834777 gtctcaagtggcattgcaaggagagaaagaacaatggtgtgttcatgaaggaatttaggttaccggagaatgcaaaagttgatgatgtcaaggcttcaat 26834876  T
139 gcatgatggagtgttgagtataaaattggttaaggatg 176  Q
    ||||||||||||||||| ||||||||||||||||||||    
26834877 gcatgatggagtgttgactataaaattggttaaggatg 26834914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 236 - 313
Target Start/End: Original strand, 26834983 - 26835060
Alignment:
236 gatggtgaaggggtttctcacaaaggaattggacgttttgtttgttgcaaagcttagaacttttcatccaaatgtgtt 313  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26834983 gatggtgaaggggtttctcacaaaggaattggacgttttgtttgttgcaaagcttagaacttttcatccaaatgtgtt 26835060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University