View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19467_high_23 (Length: 364)
Name: NF19467_high_23
Description: NF19467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19467_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 342
Target Start/End: Complemental strand, 21007270 - 21006929
Alignment:
| Q |
1 |
accaccagcttgactctggttttgctctcgccacacgataaactcagaattctgagtagcctctaaatctaggctttcagattcggagcattgctccgga |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21007270 |
accacaagcttgactctggttttgctctcgccacacgataaactcagaattcagaatagcctctaaatctaggctttcagattcggagcattgctccgga |
21007171 |
T |
 |
| Q |
101 |
tggcctggagggatacaacaaatacactcatgggcgcacctgttttaaggacaaagcaatgcatacttgtgtttctaggacttcaaagaatccgcgtaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21007170 |
tggcctggagggatacaacaaatacactcatgggcgcacctgttttaaggacaaagcaatgcatacttgtgtttctaggacttcaaagaatccgcgtaat |
21007071 |
T |
 |
| Q |
201 |
tgtcgaacaactttctcttttggtgaagggatacccaactttgaggccatgccttgtgttcccgtgaactttgaccatcgtaaagaacagatgaagcgaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21007070 |
tgtcgaacaactttctcttttggtgaagggacacccaactttgaggccatgccttgtgttcccgtgaactttgaccatcgtaaagaacagatgaagcgaa |
21006971 |
T |
 |
| Q |
301 |
ggaagttgctctttgtaccacaccagaactggaacaccttca |
342 |
Q |
| |
|
||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21006970 |
ggatgttgctctttgtaccataccagaactggaacaccttca |
21006929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University