View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19467_high_43 (Length: 266)
Name: NF19467_high_43
Description: NF19467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19467_high_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 63 - 255
Target Start/End: Complemental strand, 13976338 - 13976146
Alignment:
| Q |
63 |
cttttcatattatgtaagaatttcattcctatatcctcgaatatagtcattatgttatgtgtcactttatcgcttcaagaaccaatatgataggaaatgt |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
13976338 |
cttttcatattatgtaagaatttcattcctatatcctcgaatatagtcattatgttatgtgtcacttcatcccttcaagaaccaatatgataggaaatgt |
13976239 |
T |
 |
| Q |
163 |
attatgttgttgatcagagatggaagtattgggcacaatgaacccaccaaaactacactcatgagaatgagcgatctttacttttttcagtat |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13976238 |
attatgttgttgatcagagatggaagtattgggcacaatgaacccaccaaaactacactcatgagaatgagcgatctttacttttttaagtat |
13976146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 77 - 110
Target Start/End: Complemental strand, 250349 - 250316
Alignment:
| Q |
77 |
taagaatttcattcctatatcctcgaatatagtc |
110 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
250349 |
taagaatttcattcctatatgctcgaatatagtc |
250316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University