View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19467_high_48 (Length: 250)
Name: NF19467_high_48
Description: NF19467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19467_high_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 43 - 243
Target Start/End: Original strand, 35043255 - 35043455
Alignment:
| Q |
43 |
accgcaccgttacggctgccttcatccatttctaccggacagatcatttacaataacctcaggggagatgacggtaatttcccctaattaaaatttttat |
142 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35043255 |
accgcaccgttatggctgccttcatccatttctaccggacagatcatttacaataacctcaggggagatgacggtaatttcccctaattaaaatttttat |
35043354 |
T |
 |
| Q |
143 |
atnnnnnnntgacaccttaaattaatttatatattattatatgtagggttaaattaaatgatatttcactcttccttttaaataagttttggttcatatc |
242 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35043355 |
ataaaaaaatgacaccttaaattaatttatatattattatatgcagggttaaattacatgatatttcactcttccttttaaataagttttggttcatatc |
35043454 |
T |
 |
| Q |
243 |
t |
243 |
Q |
| |
|
| |
|
|
| T |
35043455 |
t |
35043455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University