View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19467_high_51 (Length: 242)

Name: NF19467_high_51
Description: NF19467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19467_high_51
NF19467_high_51
[»] chr4 (1 HSPs)
chr4 (25-242)||(37769115-37769327)


Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 25 - 242
Target Start/End: Original strand, 37769115 - 37769327
Alignment:
25 gcaagaaaatttatatgatgagaggaaattcaatataaagagtatgctgtgcaacatatatgagctttttaaattacgtttaagtnnnnnnnnntgttgt 124  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||            |||    
37769115 gcaagaaaatttatatgatgagaggaaattcaatataaagaatatgctgtgcaacatatatgagctttttaaattacgtttaagtaaaaaaa-----tgt 37769209  T
125 caagatattcctattgtttcaaattaattaaggtgcaaaatgagcacttaattacctttcgaaaataagagcaagaggaatagtagtaacagctgcaaag 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37769210 caagatattcctattgtttcaaattaattaaggtgcaaaatgagcacttaattacctttcgaaaataagagcaagaggaatagtagtaacagctgcaaag 37769309  T
225 gcgagacgataggctgca 242  Q
    ||||||||||||||||||    
37769310 gcgagacgataggctgca 37769327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University