View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19467_low_46 (Length: 261)
Name: NF19467_low_46
Description: NF19467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19467_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 13 - 206
Target Start/End: Original strand, 39653598 - 39653790
Alignment:
| Q |
13 |
aatatgattttcatctatttcaattgaaatacggcgtgttgtcagtgatgatttttgttcactttgtaaaaaacggtgaaaaaactttaacattggctac |
112 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||| | || |||||||||||||||| |||||||||| || ||||||||||||||||| | |||| |
|
|
| T |
39653598 |
aatatgatgttcatctatttcaattgaaatacggcttgtcgacaatgatgatttttgttcattttgtaaaaaccg-tgaaaaaactttaacatcgcctac |
39653696 |
T |
 |
| Q |
113 |
ctatacccacggacagttttttaaaaccttgatcatcactatgcaacataaaatattaggttgaaattcaatcatagaatatgaatccgttcaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
39653697 |
ctatacccacggacagttttttaaaaccttgatcatcactatgcaacataaaatattagattgaaattcaattatagaatatgaatccgttcaa |
39653790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University