View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19467_low_48 (Length: 252)
Name: NF19467_low_48
Description: NF19467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19467_low_48 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 12 - 144
Target Start/End: Original strand, 4523208 - 4523340
Alignment:
| Q |
12 |
gaacaagcagaacgaaattgagtgaataacggcaaaggcaaacccttgtgaaccaaaaaatataacaactaaatctagcaatacgtgctacaagcacatt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4523208 |
gaacaagcagaacgaaattgagtgaataacggcaaaggcaaacccttgtgaaccaaaaaatataccaactaaatctagcaatacgtgctacaagcacatt |
4523307 |
T |
|
| Q |
112 |
taaatactccccttgtcccaaagtataagtgcg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4523308 |
taaatactccccttgtcccaaagtataagtgcg |
4523340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 224 - 252
Target Start/End: Original strand, 8983589 - 8983617
Alignment:
| Q |
224 |
ataattttgtaaaataactcataatattt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8983589 |
ataattttgtaaaataactcataatattt |
8983617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 224 - 252
Target Start/End: Original strand, 40100659 - 40100687
Alignment:
| Q |
224 |
ataattttgtaaaataactcataatattt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40100659 |
ataattttgtaaaataactcataatattt |
40100687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University