View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19467_low_51 (Length: 246)
Name: NF19467_low_51
Description: NF19467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19467_low_51 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 74 - 229
Target Start/End: Complemental strand, 15672187 - 15672032
Alignment:
| Q |
74 |
gttccactcaatctggaatcaacattctccaaaattatgtcaagccatctttcatttatttggcatttaaaaccgttgtaccacacatcaactctcttta |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15672187 |
gttccactcaatctggaatcaacattctccaaaattatgtcaagccatctttcatttatttagcatttaaaaccattgtaccacacatcaactctcttta |
15672088 |
T |
|
| Q |
174 |
atgctggtaaatggtaatatattggggataattggaccacgtctaatgtaacattt |
229 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15672087 |
atgctgttaaatggtaatatattggggataattagaccacgtctaatgtaacattt |
15672032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University