View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19467_low_55 (Length: 215)
Name: NF19467_low_55
Description: NF19467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19467_low_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 9336783 - 9336967
Alignment:
| Q |
18 |
gaaaacgactatccttccattctgataacattattcttcgcactcaagccctagctatctctaccaatgcgcaccc----aatgacgtgggaagccctaa |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9336783 |
gaaaaagactatccttccattctgataacattattcttcgcactcaagccctagctatctctaccaatgcgcacccaattaatgacgtgggaagccctaa |
9336882 |
T |
|
| Q |
114 |
tgtcgaaaaagtatcttaatatatataacttatgactacacttttctactttcaccactaaaccacttccatttggattgaaatatt |
200 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
9336883 |
tgtcggaaaagtatctta--atatataacttatgactacacttttctactttcaccaccaacccacttccatttggattgaaatatt |
9336967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 161 - 196
Target Start/End: Complemental strand, 35918243 - 35918208
Alignment:
| Q |
161 |
actttcaccactaaaccacttccatttggattgaaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35918243 |
actttcaccactaaaccacttccattttgattgaaa |
35918208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University