View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19467_low_57 (Length: 210)
Name: NF19467_low_57
Description: NF19467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19467_low_57 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 19 - 199
Target Start/End: Original strand, 40776193 - 40776374
Alignment:
| Q |
19 |
cacaacaatataattgtttttcgtgaaaattatatgaattttttgtggacgtaaaatctcgttgagttgaactagcttgtccatttccccttt-gaaatt |
117 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||||| | ||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
40776193 |
cacaacaatataattatttttcgttaaaattatatgaattttttgtggacttgaaatctcgttgcgttgaactagcttgtccatttccccttttgaaatt |
40776292 |
T |
|
| Q |
118 |
tgatgaggaatgagtggcaacctaacacacatggaaaaagctatgcactttctctatctctagcaacaaacagaataatcta |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40776293 |
tgatgaggaatgagtggcaacctaacacacatggaaaaagctatgcactttctctatctctagcaacaaacagaaaaatcta |
40776374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University