View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19468_high_2 (Length: 263)
Name: NF19468_high_2
Description: NF19468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19468_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 75 - 181
Target Start/End: Complemental strand, 24347796 - 24347689
Alignment:
| Q |
75 |
ggatagtggcacctaacagaactccaatatatcctctcaaaagagagttttattcccgttgcggtctta-cttttcaataaattgatcttttacaattat |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| | ||||||||||||||||||||||||||| |
|
|
| T |
24347796 |
ggatagtggcacctaacagaactccaatatatcctctcaaaagagagttttatatccgttgcagtcttaccggttcaataaattgatcttttacaattat |
24347697 |
T |
 |
| Q |
174 |
gactatga |
181 |
Q |
| |
|
||| |||| |
|
|
| T |
24347696 |
gacaatga |
24347689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 192 - 224
Target Start/End: Complemental strand, 24347676 - 24347644
Alignment:
| Q |
192 |
aagaaaacaactatgaaatatgaaattatttat |
224 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
24347676 |
aagaaaacaaccatgaaatatgaaattatttat |
24347644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University